3551_slr6096-sacB

Accession
slr6096
Barcode
CAGGAAGCGTGGGTTCAT
Plasmid made
no
Plasmid info
[empty]
Mutant made
no
Mutant segregated
[empty]
Mutant info
[empty]
Gene Homology
Chromosome segregation ATPase
Gene ID
[empty]
CDS
ATGCAATATTTTGATTTTTTGCCGGAGATTACTGAGAAGTCGCAAATTAAGGATTTTGTGGCGAATGATGCGGGGGTGAAGACCCAGGAGGCAAGGCTCTATGGGGCGTTTGACGAGTGGTGGTGGTTGCATTCGCCGATGTTGAACCAGTTGCCGGAGTCGAAGGGTTTGATGGAGCTGCGGACGGCGTTTTTTGAGTCGTTTATTGCTAGTTTGGAGCCTGTGGGTCTGTTGGATCGGTTTAAGGTGACGGGGGTTATTGCCACTTGGTGGGATGAGGTACGGTATGAGTTGCGGACGTTGGCGGAGTCTGGTTTTTCAGGGTTGGTGGATAGTTGGATTGATACGATTCGGGATGCTCTGGAGGATGACGATGATGATCAGCCTAAGGGTAAAGAGCAGTTTGATCCGTTGAGCCACAAGTTAGTGGTACAGCTTTTGGCGGATTATCTGGAGGAAATTGAAGCGGCGGAAGGTCTGGTGGCGGATCTGGAACAGCAAAAGGTAGCGTTTGAGCAGGGGGATGATGATGCTGAAGAATCAGATGACGATGAGGAGGAAACGGTGAAAAATGTGGCCAAGGCTCTGGACGATCGCCGGAAGGATCTCAAGAATGACATTAAGGATGCTCTGAAACGGATCAAAGTGCTGAAGAGTGGGGCAACGGTGAAGGGGCAGAATTCGATCGCCGCCCAAAGAAAGTTAGGCAATGATACGACGGCACTGGAGCGGGAACTTGTGGAACTGGAGGGGTTTGTGGCTCCGGTGTTGGCTGAGATTGGGGAAATTGAGGCGAGGTTGGAACCCTATAACGAGATTAAGGCTAGTTTGGCGGAGGCCCGGAAGGCTTTACGGGGGTTGAAGGATCAACTTATTGGGCGGTTAGTGGCGGCACGGGCAGAGCTTGGTGAGGAGGGTTGTGAAAAGTTGGTGTTGGCGGCGTTTTATGAGGGGCTAAAGTCCCATCTGGATCGCTATGGGGCGGCGCATTTTCAGCAGGTGGTGGCGGCGGTTGAGAATTGGTGGGATAAGTATCGGGTGACGTTGCGGGATATTGTCAGCGAACGGGACACTGCGGCGGCAAAGTTAGATCAGTTTTTGGAGGGATTGGGATATGTCTAA
CDS Length
1122 bp
Strand
Positive
Up flank
TATTTTGGTGATGCGTCGGGCTGGGGAAAAACTACCGGAACGTCGGGGCAAGGTGCTATTTATCAATGCGGATGCGGAGTTCTATGCCGGTCGGGCCCAGAATTATTTGAAGCCGGAGCATATCGAAAAAATTGTGAATGCGTTTGAGGCATTTGTGGATATTCCAGGTTATGCGGCGGTGGTCAGTCGGGAAATTTTGGCTGCTGAGGAGAATGATTTTAATTGCAATATTCGGCGTTATGCGGATAATGCGCCACCACCGGAACCGCAGGATGTGACGGCTCATTTGTTGGGGGGGATTCCTTTCGATGAGATAGAAGCACAACGGAATTTGATGGGCAGTCATGGGTTTGACCCGCTGCGAATTTTAGTGGAAAAGGCTTAGGGAGATTTTGGTA
Up flank length
398 bp
Down flank
ATGTCTAATAATTGGAATATATTAAATTTTGGAAATTTGATAATTCTCGAATATGGCAATACTTTAACAGAAGAAAATAGAAGTGGTGGAGATTATCCCGTTTATGGATCTAATGGAATTATTGGATTCCATAAAGCTTATTTATTAGATTCTCCTAATATAATTGTTGGGCGTAAAGGCAGCGTAGGCGAAGTAGTTTGGGCAAATAAAAATTGTTGGGCTATTGATACCACTTATTATGTAACTTTAAAACAAGACAATAGTTTACGCTTCATTTATTGGTTATTAAAGTCTTTTGATTTGAGAAAACTTGATAGTTCTACAGGAGTACCTGGACTTAATCGAAATGATGTTTATAGAATTAAATGCAATTTGCCATCACTGCCAGAGCAGGAAAA
Down flank length
398 bp
Map (Benchling)
[empty]
Parts (SynBioHub)
[empty]