0118_slr0744-codA

Accession
slr0744
Barcode
GGAGGGGGGAGGCGGCGG
Plasmid made
yes
Plasmid info
[empty]
Mutant made
no
Mutant segregated
[empty]
Mutant info
[empty]
Gene Homology
initiation factor IF-2
Gene ID
infB
CDS
ATGAACAACGCCAAAGTCAGAATTTATGACCTATCAAAAGAATTAAATCTGGAGAATCGAGATATTTTAGACATCTGCGAACGGCTCAACGTGGCTGCTAAAAGTCATAGCAGTACCATCAGTGAATCCGATGCGGAGCGCATCAAAGCGGCAGCTGAAAAATTCACCCCCCAACAACCGAAAAAGCCTAGAGTGGCATCCCGTCCGGAGTCGAAAGAGGATAAGTCAGATCCCAAGCAGCAAAAGATTCTAGCAATTCACCACAAACAGGAAAAATCTGGCGGTCCATCTCCGGCCCGGCCCACCCCCCCTCCCCGGCCAAAACTACAAGCGCCGAAGGCCCCCACGCCCCCCCAACCCCCCGTGGCCAAAGCTTCAGCTCCAAAGATTCAGAAACAGGAAGAGCCTGCCCAGGAAGCGCCCAAAAGTGTTGCTCCCCCCACCCAGCCTTTGGCACCGCCCCCAGTGCCCAGTTTGCAATCTCCCCCCAGTAAGCCAGCTCCCCCTACTCCTCCTGCAAAGAAAGCGGCTCCAGCCCCCCGTTTGGCAGGGCCTCCTGGTCGAACAGCCAGTCCCAACAAAACCGCTGTCCCTGCCCCCGCTAAACCCAAGGTTAACCGTCCGGAAATTGTTAGTTTGAAGGATAATCGGGGTCAAGCCCGCTCCCCCGGTGACAGGGAAGAGAAGGTGGCGATCGCCGCTCCGGAACCACCTAAGCCCAAGGTAGAATTGCGCCGGCCCAAGCCCCCCCGGCCTGAAGAGGACGAAAACTTACCAGAATTGCTGGAATTTCCGCCCCTTAGTCGGGGCAAGGGGGTCGATGGGGACAACGATGCCGATGACGGTGATCTGCTCTCCACCGAGAAACCCAAGCCCAAGCTGAAGCGCCCTACTCCTCCGCGTTTGGGTAAGCCAGATCAGTGGGAAGATGACGAAGACGAAAAAGCCAATAAGGCCAAAGCGGCCAACAAGGGCAAACGCCGGCCCAAAATGGACGACGATGACGATGACCTGGATATAGATGGGGATAATGGACCCAAGCCTACCCTGGTTAGTCTTTCCATTGCCCGTCCACCTAAACCAAAATCCTTGGCGGCGAAACCCAGCACCCCCACTGTGGCCAAGGTTAAAAAGCCCACTCTCAAATCCGAAGCGGGTAGTAGCGCTGGTGGTAGTTCCCGCAGTCGTGGCGATCGCCGGGATCGGAAGGAAGTGGTGCAAAAACCCGAAGTGATCATGTTGGACCGGAGCTTGACTGTCCGGGATCTGGCGGATCTATTAAAAATTTCCGAAACAGACATCATCAAACGGCTCTTCCTCAAAGGGGTAGCGGTGCAAATTACCCAAACCTTGGACGAAGAAACCGCCCGTATGGTGGCCGAATCCTTTGAAGTGGCCGTGGAAACCCCTGAAAGGGTCGCCGCCGCCGCTAAAACCACAGAAATGCTCGACGAAGCGGATCTGGACAACCTCGTACGTCGTCCCCCTGTGGTTACCATCATGGGTCACGTGGACCACGGTAAAACCACGTTGCTGGACTCCATACGCAAAACCAAGGTGGCCCAAGGGGAAGCGGGGGGTATTACCCAGCACATTGGTGCCTACCACGTGGAAGTGGAGCACAACGACAAAACCGAACAGATTGTCTTCCTTGATACTCCTGGCCATGAAGCCTTTACCGCCATGCGGGCCCGGGGAGCCAAGGTTACGGACATTGCCATTCTGGTGGTAGCCGCCGATGATGGCGTCCAGCCCCAAACCAAAGAGGCCATTAGCCATGCCAAGGCCGCCGGGGTTCCCCTCATTGTGGCCATCAACAAAGTCGATAAACCTGAAGCCAATCCCGACCGCATTAAGCAGGAATTGTCCGAACTTGGCCTTCTGGCTGAAGAATGGGGGGGAGACACCATCATGGTGCCCGTCAGTGCCCTCAACGGAGATAACCTGGATGGCTTGCTCGAAATGATTCTGCTCGTATCGGAAGTGGAAGAACTAGTTGCTAATCCCAACCGTCAGGCTAAAGGCACCGTGATTGAGGCTAACCTAGACCGCACCAGGGGTCCTGTGGCTACCCTCTTGATCCAAAACGGTACTCTCCGAGTTGGGGATGCTATTGTGGTGGGGGCTGTGTACGGCAAAATCCGAGCCATGATCGACGACCGGGGCGACAAAGTCGAGGAAGCCAGTCCTTCCTTTGCAGTGGAGATCCTTGGTCTAGGGGATGTGCCCGCCGCTGGGGATGAATTTGAAGTCTTTACCAACGAAAAAGATGCCCGTCTGCAAGCGGAAGCCCGGGCCATGGAAGACCGTCAAACCCGTCTGCAACAGGCCATGTCTTCCCGCAAGGTTACCCTCAGCAGTATTTCGGCCCAGGCCCAGGAAGGGGAACTCAAGGAACTCAACATCATCCTCAAGGCAGACGTACAGGGTTCCTTGGGGGCTATTTTAGGCTCCTTGGAACAATTACCCCAAGGGGAAGTACAGATCCGAGTCCTGTTGGCGTCCCCAGGGGAAGTCACGGAAACCGATGTGGATTTGGCCGCCGCCAGTGGAGCAATCATCATTGGCTTCAACACCACCTTGGCCAGTGGAGCCCGTCAAGCCGCGGACCAAGAAGGGGTGGACATTCGGGAATACGACATCATCTATAAGCTTTTGGATGACATCCAAGGAGCCATGGAAGGTCTCTTGGATCCCGAAGAAATTGAGTCTTCCCTGGGAACAGCGGAAGTGCGGGCTGTCTTCCCCGTGGGTCGGGGTAATATTGCCGGTTGTTACGTGCAGTCAGGCAAAATTATCCGGAATCGTAACCTGCGGGTGCGCCGGGGTGACCAAGTGCTCTTTGAAGGCAACATCGATTCCCTCAAACGGATTAAGGAGGACGTGCGGGAAGTTAATGCTGGCTATGAGTGCGGCATTGGCTGTAGCAAGTTCAACGACTGGAAGGAAGGAGACATCATCGAAGCCTATGAAATGACCATGAAGCGTCGGACATTGGCTACCTAG
CDS Length
3006 bp
Strand
Positive
Up flank
CCAGCGGCAGTTATCGTTAGTTAGCATTAGGAGTAAAACCATTTACTATTTCGGCTTCACCTTATCGACTCCGCAAAGCTTTCTTGGGGACAATGCCCCTGGAAAAAGCTAGTGCTCTGTCTGTGCACCTAGTCTTTGCACTCACATAAACCAATTTGTCACTTATTAAATTTATGGATCATTAGTCAGGGGGACAGTGG
Up flank length
200 bp
Down flank
GATGTTGTTGCTCCAATTCAGCACTTCCCACTATTGCCGCAAAGCTAGGCTGGCCTTGGGTTATAAGGGCATTATTTACCGAGTTAAAAATTTAACTCCCGGTGTCCATGCCCTGCAACTTAAACCCAAGACCGGTGCCACTACTGTGCCAGTACTTTGTCCAGAACTCCCAGGACAACCGGAATGTATCAGTGATTCCA
Down flank length
200 bp
Map (Benchling)
[empty]
Parts (SynBioHub)
[empty]