0030_slr1489-sacB

Accession
slr1489
Barcode
[empty]
Plasmid made
no
Plasmid info
[empty]
Mutant made
no
Mutant segregated
[empty]
Mutant info
[empty]
Gene Homology
regulatory protein; PchR
Gene ID
pchR
CDS
ATGTCGATCTTTTTTTCTCAATCTGATTACTTGGCCATGTTCAGGGAAGGAGGCAATCAACAGCAATCTAATGCAGATGGCTCGGATAAATATTGGTATTATCCAACGCATTTAGGGCGTGGATCTATACGGGAGATAAAACTTCGAGAAGGCTTAGAACTGACGATAGCTAGCTATCAACTCTATCAAAATCTTATTGTTGAAATTCCCGAGCGGGAACACCCATTGGAATATGAATTTACGGTTATTGGAGAACACCACCGTCAGTTAACCGGGGCTGATGCAGAAAATTATTTCTTTTCCGGTAGTGGCTTAGCAGATAAAAGTGTGAATGAATATCTGGCGGGATGGCAGGTTTTAAATGTTAGTTTTCATCTAGAGCCTGATTTATTTCGTACCTGGATAGGCGATCGCCTAGAGCAAGCTGAAACCATTATTCAAGAATTGCTCAAAGACCTAAACTCAGTTCGCTACACCCACACAGCCACACCTACAGTTAAGATGCAGACGGCATTGCAGCAGATTTTATATTGTCCCTACAGGGGAATTATCCAACAGATTTATCTAGAAAGTAAAGTCTGGGAACTCATGGCTCTCCACCTTGAGCAGATGCTACAAAATTCCTCTCCCAACTTGACCCAACCAACCCTTAAACCAGATGATATTGAACGAATTCACCATGCCAGAGAAATTTTATCCCAGTGCCTCTGTAACCCACCTTCCTTAAAAGGATTGGCTCGTCAGGTGGGCTTGAATGAATTTACTCTTAAACAGGGTTTCCGCCAAGTTTTTGGAACTACCGCATTCGGTTGGTTGCACCATCACCGTATGGAAAGGGTCAAAGAATTACTAGAAACGGGCCATTACAACGTCACTGAAGCTGCTCGGGAAGTGGGGTTTTCCAATCGGGGACATTTTGCCGCCTCGTTCCGCAAAAAGTTTGGCGTTAATCCTAAAGCCTATTCATTGTTTGCCAAACAACCTAAAGACTAA
CDS Length
993 bp
Strand
Positive
Up flank
[empty]
Up flank length
0 bp
Down flank
[empty]
Down flank length
0 bp
Map (Benchling)
[empty]
Parts (SynBioHub)
[empty]